Chst10 antibody thermo

WebBuy rabbit polyclonal antibody to CHST10 (A37117). Validated Applications: WB and IHC. Tested Reactivity: Human. ️ Low Prices ️ 100% Guarantee WebAnti-CHST10 Antibody Products from Thermo Fisher Scientific. Anti-CHST10 antibodies are offered by a number of suppliers. This target gene encodes the protein 'carbohydrate sulfotransferase 10' in humans and may also be known as HNK1ST, HNK-1ST, HNK-1 sulfotransferase, and huHNK-1ST. Structurally, the protein is reported to be 42.2 …

CHST10 antibody (12013-1-AP) Proteintech - ptglab

WebFeb 2, 2013 · A Chst10 targeting vector was constructed as shown in Fig. 1. Homologously recombined ES clones were selected by Southern hybridization using a probe adjacent to the targeting vector. Probe DNA (about 450 bp) was amplified by PCR using the following primers: 5–12s, TGTAGTCAAGGCAGCAACCAAGCA, and 5–13a, … WebView Rabbit Polyclonal anti-Carbohydrate Sulfotransferase 10/CHST10 Antibody [DyLight 488] (NBP2-97238G). Validated Applications: IHC, IHC-P. Validated Species: Human. grafton group investor relations https://rubenamazion.net

Anti-CHST10 antibody (GTX87551) GeneTex

WebRabbit Polyclonal CHST10 antibody Internal Region for ELISA, ICC, IF, IHC, WB. Order anti-CHST10 antibody ABIN6258961. language English local_shipping United States phone+1 877 302 8632; Contact; person Login favorite_border Comparison List shopping_cart Basket menu; north; arrow_back. search. search. Phone: +1 877 302 … WebCarbohydrate Sulfotransferase 10/CHST10 Antibody [DyLight 680] (NBP2-97238FR): Novus Biologicals View Rabbit Polyclonal anti-Carbohydrate Sulfotransferase 10/CHST10 Antibody [DyLight 680] (NBP2-97238FR). Validated Applications: IHC, IHC-P. Validated Species: Human. Skip to main content Support: 1-888-506-6887 Items in Cart (0) [X] … china could learn a few things from japan

Anti-CHST10 Antibody Products from Thermo Fisher Scientific

Category:Anti-CD16/CD32 Antibodies Invitrogen - Thermo Fisher

Tags:Chst10 antibody thermo

Chst10 antibody thermo

Anti-CD16/CD32 Antibodies Invitrogen - Thermo Fisher

WebAntibody: Immunogen: CHST10 fusion protein Ag2627: Full Name: carbohydrate sulfotransferase 10: Calculated molecular weight: 356 aa, 42 kDa: Observed molecular … WebCHST10 Antibodies. Antibodies that detect CHST10 can be used in several scientific applications, including Western Blot, Immunohistochemistry, Immunocytochemistry and …

Chst10 antibody thermo

Did you know?

WebAnti-CHST10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody; Synonyms: HNK-1ST; find Sigma-Aldrich-HPA051545 MSDS, related peer-reviewed papers, technical documents, similar products & more at Sigma-Aldrich WebCHST10 Polyclonal Antibody Product Details Size 100 µL Species Reactivity Human, Mouse, Rat Host / Isotype Rabbit / IgG Class Polyclonal Type Antibody Conjugate …

WebAnti-CHST10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution; Synonyms: Anti-Carbohydrate sulfotransferase 10,Anti-HNK-1 sulfotransferase,Anti-HNK-1ST,Anti-HNK1ST,Anti-huHNK-1ST; find Sigma-Aldrich-HPA012884 MSDS, related peer … WebAnti-CHST10 Antibody Products from Thermo Fisher Scientific Anti-CHST10 antibodies are offered by a number of suppliers. This target gene encodes the protein 'carbohydrate …

WebCHST10 Antibody (PA5-106630) in ICC/IF. Immunofluorescent analysis of CHST10 in HUVEC cell lysate. Samples were fixed with paraformaldehyde, permeabilized with 0.1% … WebThere are currently no images for Carbohydrate Sulfotransferase 10/CHST10 Antibody (NBP2-97238IR). Every product we sell is backed by Novus' 100% Guarantee . If you …

WebIHC-P analysis of human lung carcinoma tissue using GTX87551 CHST10 antibody. The picture on the right is blocked with the synthesized peptide. GTX87551 WB Image WB analysis of HUVEC cell lysates using …

WebA superior strategy for validation of antibody: Blocking peptide validation; Independent Antibody Verification; phospho-antibody made by Affinity; Fruit fly studies guide investigators to misregulated mechanism in human cancers; G Protein-Coupled Receptors (GPCRs) win 2012 Nobel Prize in Chemistry grafton group home winchester vaWebAntibodies. Protein structure ... CHST10 is part of cluster 22 Rhabdoid cancers - Neuronal signaling with confidence i 1 291 genes in cluster Go to interactive expression cluster page. 15 nearest neighbours based on cell line RNA expression. Neighbour i. Description i. ... grafton group plc dividendWebCHST10 (HNK-1ST) protein expression summary. We use cookies to enhance the usability of our website. If you continue, we'll assume that you are happy to receive all cookies. ... Antibody specificity analysis with protein arrays. Predicted and matching interactions are shown in green. Antibody dilution: 1:3000: 1:500: ANTIGEN INFORMATION; grafton group plc annual reportWebAntibodies that detect CD16/CD32 can be used in several scientific applications, including Flow Cytometry, ELISA, Functional assay, Immunohistochemistry and Immunoprecipitation. These antibodies target CD16/CD32 in Mouse and Rhesus Monkey samples. Our CD16/CD32 monoclonal, polyclonal and recombinant monoclonal antibodies are … china countermeasuresWebWe offer a wide range of validated CHST10 antibodies. Order online or by email, fax, or phone. ️ Low Prices ️ 100% Guarantee ️ FREE Shipping grafton forest projectWebThermo Fisher Scientific's CHST10 Antibody is a Rabbit Polyclonal antibody. This antibody has been shown to work in applications such as: Immunohistochemistry, … grafton group market capWebFawn Creek Township is a locality in Kansas. Fawn Creek Township is situated nearby to the village Dearing and the hamlet Jefferson. Map. Directions. Satellite. Photo Map. grafton group plc dividend history